WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00130517 Gene Name  CJA11313
Sequence Name  ? CJA11313 Organism  Caenorhabditis japonica
Automated Description  Is an ortholog of C. elegans K05C4.9; F53G2.1; and F12F6.8. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA11313.1 CJA11313.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA11313 CJA11313   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA26868, CATCGCCAATTTCATTAGAGACGAGCAGGCGGAAGAGATTTCTGACAAGATGATCATCAC, WBGene00182440   Expr1084090 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA11313, ACAGGATTGGAAATTGTGTTGAGCATGGTGAAGAGCTCTAATTACGCGTGCAAGTCGTTT, WBGene00130517   Expr1078370 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term