WormMine: Gene WBGene00130552

• WormBase Gene ID: WBGene00130552
• Gene Name: Cjp-arrd-23
• Sequence Name: CJA11348
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Arrestin (or S-antigen), N-terminal domain; Immunoglobulin E-set; Arrestin C-terminal-like domain; Arrestin-like, C-terminal; Arrestin-like, N-terminal; and Arrestin (or S-antigen), C-terminal domain. Is an ortholog of C. elegans arrd-23.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA11348.1	CJA11348.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA11348	CJA11348		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081736
• Remark: CJA11348, TTTGAGATTAAAGTGAGGTCGGGTGGAATTGATGTAATTGAATTGAGCGTACCAGTTGTA, WBGene00130552
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term