WormMine: Gene WBGene00130542

• WormBase Gene ID: WBGene00130542
• Gene Name: Cjp-arx-2
• Sequence Name: CJA11338
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Actin; ATPase, nucleotide binding domain; Actin-related protein 2; and Actin family. Is an ortholog of C. elegans arx-2. In C. elegans, arx-2 is involved in Arp2/3 complex-mediated actin nucleation; embryonic morphogenesis; and epithelial cell migration.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA11338.1	CJA11338.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA11338	CJA11338		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1077285
• Remark: Cjp-arx-2, CAAATCTGATGAAGGATCGTGACCAGGACTTTTGGGTGTCCAAGAAAGATTATGAGGAAG, WBGene00130542
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term