WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00130414 Gene Name  CJA11210
Sequence Name  ? CJA11210 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Reverse transcriptase domain; Reverse transcriptase (RNA-dependent DNA polymerase); DNA/RNA polymerase superfamily; and Endonuclease/exonuclease/phosphatase superfamily. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA11210a.1 CJA11210a.1   [unknown]
Transcript:CJA11210b.1 CJA11210b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA11210b CJA11210b   [unknown]
CDS:CJA11210a CJA11210a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA06308, TACAAGGATCTGAAGAAAGTATACACACGGCTATCGAAGTGGGATTCGTCGATCATCATC, WBGene00125512   Expr1077825 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA00423, GAAGTGGACCTGGATCAGTCCGAACGGCAAAACGAAGAACGAAATCGACTTCATTCTCAC, WBGene00119627   Expr1079610 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term