WormMine: Gene WBGene00130379

• WormBase Gene ID: WBGene00130379
• Gene Name: Cjp-lron-11
• Sequence Name: CJA11175
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Leucine-rich repeat; Leucine-rich repeat, typical subtype; Leucine-rich repeat domain superfamily; and Leucine rich repeat. Is an ortholog of C. elegans lron-11.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA11175c.1	CJA11175c.1		[unknown]
Transcript:CJA11175b.1	CJA11175b.1		[unknown]
Transcript:CJA11175a.1	CJA11175a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA11175c	CJA11175c		[unknown]
CDS:CJA11175b	CJA11175b		[unknown]
CDS:CJA11175a	CJA11175a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1078703
• Remark: CJA11175, GCTCTACAGTACCTCAATATATCGCATTCGAGGAATTTGAAGACTATTCAGGTACGGTGT, WBGene00130379
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term