WormMine: Gene WBGene00036530

• WormBase Gene ID: WBGene00036530
• Gene Name: Cbr-mps-4
• Sequence Name: CBG16649
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: MinK-related peptide, potassium channel accessory sub-unit protein 4 and Potassium channel accessory subunit protein 4, MinK-related. Is an ortholog of C. elegans mps-4. In C. elegans, mps-4 is involved in regulation of potassium ion transport.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16649.1	CBG16649.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16649	CBG16649		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055635
• Remark: Cbr-mps-4, TTCTCGTTTGGTGCTATTTTTCTGATTCTCTGGGCAGACTTTTTGTTAAATTCAGTTAGA, WBGene00036530
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term