WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00133350 Gene Name  CJA14146
Sequence Name  ? CJA14146 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: HTH domain in Mos1 transposase; Mos1 transposase, HTH domain; Thrombospondin type 1 domain; Thrombospondin type-1 (TSP1) repeat superfamily; and Thrombospondin type-1 (TSP1) repeat. Is an ortholog of C. elegans Y8A9A.2. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA14146.1 CJA14146.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA14146 CJA14146   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA14146, ACTGTGTGTCTTTTCCCGAGAACATCTTGCTGCTCTCCATATACGAAAAAGATAGTTAAT, WBGene00133350   Expr1080646 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term