WormMine: Gene WBGene00132668

• WormBase Gene ID: WBGene00132668
• Gene Name: CJA13464
• Sequence Name: CJA13464
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: LIM domain and Zinc finger, LIM-type. Is an ortholog of C. elegans tag-273.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA13464a.1	CJA13464a.1		[unknown]
Transcript:CJA13464b.1	CJA13464b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA13464b	CJA13464b		[unknown]
CDS:CJA13464a	CJA13464a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1087042
• Remark: CJA13464, AAGATGAACATGTCGCTTCCGACGAGGAAGAGTTTGCCGTCTCCAGTAAACCAAAACAAC, WBGene00132668
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term