WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00132699 Gene Name  CJA13495
Sequence Name  ? CJA13495 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domain: Protein O-mannosyl-transferase TMTC, DUF1736. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA13495c.1 CJA13495c.1   [unknown]
Transcript:CJA13495a.1 CJA13495a.1   [unknown]
Transcript:CJA13495b.1 CJA13495b.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA13495a CJA13495a   [unknown]
CDS:CJA13495c CJA13495c   [unknown]
CDS:CJA13495b CJA13495b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA18683, CTAGGTGGAAATGCACAAATCGACCCGAACAGTATATTTGTATTCAGATTATTCACGTGA, WBGene00137886   Expr1086726 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA13495, CCAATGAACGCCAAGATTCATTACAATCTGGGAAAGGTTATGGGAGATAGCGGTCTGACA, WBGene00132699   Expr1076231 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term