WormMine: Gene WBGene00132681

• WormBase Gene ID: WBGene00132681
• Gene Name: Cjp-lron-8
• Sequence Name: CJA13477
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Leucine-rich repeat; Leucine-rich repeat, typical subtype; Leucine rich repeat; Leucine-rich repeat domain superfamily; and Cysteine-rich flanking region, C-terminal. Is an ortholog of C. elegans lron-8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA13477b.1	CJA13477b.1		[unknown]
Transcript:CJA13477c.1	CJA13477c.1		[unknown]
Transcript:CJA13477a.1	CJA13477a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA13477a	CJA13477a		[unknown]
CDS:CJA13477c	CJA13477c		[unknown]
CDS:CJA13477b	CJA13477b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1076299
• Remark: CJA13477, AAAGTATAGAGAGCGCCTGGTCCACATGAGCCCAACGCCAGTCGGCTACCATAATCTTCA, WBGene00132681
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term