WormMine: Gene WBGene00132561

• WormBase Gene ID: WBGene00132561
• Gene Name: Cjp-unc-122
• Sequence Name: CJA13357
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Collagen triple helix repeat (20 copies); Olfactomedin-like domain; and Collagen triple helix repeat. Is an ortholog of C. elegans unc-122. In C. elegans, unc-122 is involved in negative regulation of cholinergic synaptic transmission.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA13357.1	CJA13357.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA13357	CJA13357		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1085456
• Remark: Cjp-unc-122, GACAATGTCATTCGTCGATTGTGGTCGCTTACCAGATCACACGTTTGAAGAGTGCAACTC, WBGene00132561
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term