WormMine: Gene WBGene00132590

• WormBase Gene ID: WBGene00132590
• Gene Name: Cjp-rpn-7
• Sequence Name: CJA13386
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Winged helix DNA-binding domain superfamily; PCI domain; 26S Proteasome non-ATPase regulatory subunit 6; Proteasome component (PCI) domain; 26S proteasome subunit RPN7; and 26S proteasome regulatory subunit Rpn7/COP9 signalosome complex subunit 1. Is an ortholog of C. elegans rpn-7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA13386.1	CJA13386.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA13386	CJA13386		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079510
• Remark: Cjp-rpn-7, CAACCTTCGGATCGTATGAGCTTATGACTTACGAGAATCTCATTCTTTACACCGTTATTA, WBGene00132590
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term