WormMine: Gene WBGene00132991

• WormBase Gene ID: WBGene00132991
• Gene Name: Cjp-zmp-1.1
• Sequence Name: CJA13787
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Hemopexin-like domain superfamily; Hemopexin-like repeats; and Matrix metalloproteinase-A. Is an ortholog of C. elegans zmp-1. In C. elegans, zmp-1 is involved in basement membrane disassembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA13787.1	CJA13787.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA13787	CJA13787		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079274
• Remark: Cjp-zmp-1, GTTGATTTGAATTGGGCCCGAGTTCCAGAAGGAGCTTATTCGGCGTTCAATTTTGAGAAA, WBGene00132991
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term