WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00132239 Gene Name  Cjp-acs-16
Sequence Name  ? CJA13035 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: ANL, N-terminal domain; AMP-dependent synthetase/ligase; and AMP-binding enzyme. Is an ortholog of C. elegans acs-16. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA13035a.1 CJA13035a.1   [unknown]
Transcript:CJA13035b.1 CJA13035b.1   [unknown]
Transcript:CJA13035c.1 CJA13035c.1   [unknown]
Transcript:CJA13035d.1 CJA13035d.1   [unknown]
 

Other

4 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA13035a CJA13035a   [unknown]
CDS:CJA13035d CJA13035d   [unknown]
CDS:CJA13035c CJA13035c   [unknown]
CDS:CJA13035b CJA13035b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA13035, TAGCGTGTGAGGAAGACTTGATTTACGACAAAAATAACTGTCTGGTGGAGCACTGGAACA, WBGene00132239   Expr1078206 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term