WormMine: Gene WBGene00132131

• WormBase Gene ID: WBGene00132131
• Gene Name: Cjp-him-17
• Sequence Name: CJA12927
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: THAP-type zinc finger and THAP domain. Is an ortholog of C. elegans him-17. In C. elegans, him-17 is involved in germline cell cycle switching, mitotic to meiotic cell cycle and resolution of meiotic recombination intermediates.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12927.1	CJA12927.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12927	CJA12927		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081615
• Remark: Cjp-him-17, GTACGAGCAAGAGGAGATTCAGGAGATTCAAGAAGTCGTGGAAGTTCAGGAAGTGGTCGA, WBGene00132131
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term