WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00135636 Gene Name  Cjp-tnsl-1
Sequence Name  ? CJA16432 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Tetratricopeptide repeat; Tetratricopeptide-like helical domain superfamily; Ankyrin repeat; Domain of unknown function DUF3447; Ankyrin repeat-containing domain superfamily; and Ankyrin repeats (3 copies). Is an ortholog of C. elegans tnsl-1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA16432.1 CJA16432.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA16432 CJA16432   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA01030, TGTGAATTGCACGAAGCGACCGGCGATTTGTTCGACAAATACTACCAAACAATGCTGGAA, WBGene00120234   Expr1071223 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA16432, GAATAAGGCGAAAATCGAGTTGAAGGACAGTGCCGGATGGACGGCGTATGATCATTTTAG, WBGene00135636   Expr1091001 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term