WormMine: Gene WBGene00135672

• WormBase Gene ID: WBGene00135672
• Gene Name: Cjp-aap-1
• Sequence Name: CJA16468
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: SH2 domain superfamily and SH2 domain. Is an ortholog of C. elegans aap-1. In C. elegans, aap-1 is involved in dauer larval development; determination of adult lifespan; and insulin receptor signaling pathway.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA16468.1	CJA16468.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA16468	CJA16468		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1086904
• Remark: Cjp-aap-1, GGATTCGAACACAGCAACGTTTACATGCCAACCATTGCCGATTTTATTCGTTATTACACC, WBGene00135672
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term