WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00135598 Gene Name  Cjp-csn-4
Sequence Name  ? CJA16394 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Winged helix DNA-binding domain superfamily; PCI domain; 26S Proteasome non-ATPase regulatory subunit 12/COP9 signalosome complex subunit 4; Proteasome component (PCI) domain; Winged helix-like DNA-binding domain superfamily; and COP9 signalosome complex subunit 4. Is an ortholog of C. elegans csn-4. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA16394.1 CJA16394.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA16394 CJA16394   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA20991, CGAACACGGAGAATCCATTTTGAAGGAGGTCATTCAGGAGCATAATATCACTGCGATCAG, WBGene00176563   Expr1083360 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-csn-4, ATTCTCAGATTCTGTCAACTCTCGAACAAGTGAACAAAGTGAGCGATATGATCGTTGCTC, WBGene00135598   Expr1073392 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term