WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00078562 Gene Name  Cre-smg-7
Sequence Name  ? CRE24664 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: DNA/RNA-binding domain, Est1-type; Tetratricopeptide-like helical domain superfamily; and Est1 DNA/RNA binding domain. Is an ortholog of C. elegans smg-7. In C. elegans, smg-7 is involved in nuclear-transcribed mRNA catabolic process, nonsense-mediated decay. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE24664.1 CRE24664.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE24664 CRE24664   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE24664, CTGAACTAGAACAACGAGCCGTTGGATATATCAGCACTATCTGGACAATTTCCTATCGAA, WBGene00078562   Expr1111902 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CRE24346, TAGATCTCCCGTAAAAGCTCAACGACGAGAAGATCCAGAATCATCCGATGAAGAGATTCT, WBGene00074417   Expr1105654 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term