WormMine: Gene WBGene00135556

• WormBase Gene ID: WBGene00135556
• Gene Name: CJA16352
• Sequence Name: CJA16352
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Sterile alpha motif/pointed domain superfamily; Uncharacterized protein C19orf47-like; Sterile alpha motif domain; and SAM domain (Sterile alpha motif). Is an ortholog of C. elegans F53F8.5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA16352b.1	CJA16352b.1		[unknown]
Transcript:CJA16352a.1	CJA16352a.1		[unknown]
Transcript:CJA16352c.1	CJA16352c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA16352c	CJA16352c		[unknown]
CDS:CJA16352a	CJA16352a		[unknown]
CDS:CJA16352b	CJA16352b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1087116
• Remark: CJA16352, GAATCCAATATTCGGACTCCTCGCGCCGCCAGAATTCGTCCGGACAAAGTGTTCATAGTC, WBGene00135556
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term