WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00074705 Gene Name  CRE13842
Sequence Name  ? CRE13842 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: NADP oxidoreductase coenzyme F420-dependent; 6-phosphogluconate dehydrogenase-like, C-terminal domain superfamily; Pyrroline-5-carboxylate reductase, catalytic, N-terminal; Pyrroline-5-carboxylate reductase dimerisation; NAD(P)-binding domain superfamily; and Pyrroline-5-carboxylate reductase, dimerisation domain. Is an ortholog of C. elegans pycr-4. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE13842.1 CRE13842.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE13842 CRE13842   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE13842, AAGACTCAACACTTCGGATTTCTCAAAGACAAGGTTTGCTCTCCTGGAGGCACAACAATC, WBGene00074705   Expr1104157 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CRE12501, GAGAAAAACGGTTTCCGTTCTGCCGTTATGGAAGCTGTTATCGCCGCATCGTCTAAGGCC, WBGene00068706   Expr1097487 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term