WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00134634 Gene Name  Cjp-magu-2
Sequence Name  ? CJA15430 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: P-loop containing nucleoside triphosphate hydrolase; PDZ superfamily; PDZ domain; Guanylate kinase/L-type calcium channel beta subunit; SH3-like domain superfamily; MAGUK p55 subfamily member 5-like; Variant SH3 domain; Guanylate kinase; and SH3 domain. Is an ortholog of C. elegans magu-2. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA15430a.1 CJA15430a.1   [unknown]
Transcript:CJA15430b.1 CJA15430b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA15430b CJA15430b   [unknown]
CDS:CJA15430a CJA15430a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-tag-117, ATATTCAGCCTTATATAGTTTTTGTGGCTGCTCCGTCGCTTCACGTGCTCCGCAGGCAGC, WBGene00134634   Expr1072862 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA24698, AATCGCTGCAAGAGTTGAAGCAGATGCTCATGAAGGTCAACACCGAGCCAATGTGGATTC, WBGene00180270   Expr1086585 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term