WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00134689 Gene Name  Cjp-ubc-9
Sequence Name  ? CJA15485 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Ubiquitin-conjugating enzyme; Ubiquitin-conjugating enzyme E2; and Ubiquitin-conjugating enzyme/RWD-like. Is an ortholog of C. elegans ubc-9. In C. elegans, ubc-9 is involved in several processes, including chordate pharyngeal muscle development; negative regulation of transcription by RNA polymerase II; and protein sumoylation. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA15485.2 CJA15485.2   [unknown]
Transcript:CJA15485.1 CJA15485.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA15485 CJA15485   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA07387, AATGGTCGTACTCGACGGAAAATCGGAAGTCGTCGAAAAAGGCAAAGCGGATCCACTTGG, WBGene00126591   Expr1072330 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-ubc-9, ACGAGTGAAGAAAGAGGCTCAGAAGTATGCGGCTGAAATTGTTCAGAAGCAAATGCTCGG, WBGene00134689   Expr1088178 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term