WormMine: Gene WBGene00236794

• WormBase Gene ID: WBGene00236794
• Gene Name: CJA46585
• Sequence Name: CJA46585
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Protein of unknown function DUF1096 and Protein of unknown function (DUF1096). Is an ortholog of C. elegans Y5H2A.4 and members of the C. elegans pqn and abu gene classes including pqn-91 and abu-5. In C. elegans, abu-1 is involved in endoplasmic reticulum unfolded protein response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA46585.1	CJA46585.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA46585	CJA46585		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1073302
• Remark: CJA23829, AAACGTGCCAACAACAATGTGCTCCACAATGCCAACAACAGGCTGCTCCCCAGTGCCAAC, WBGene00179401
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term