WormMine: Gene WBGene00134757

• WormBase Gene ID: WBGene00134757
• Gene Name: Cjp-sym-3
• Sequence Name: CJA15553
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: N-terminal C2 in EEIG1 and EHBP1 proteins; Protein FAM102-like; and NT-type C2 domain. Is an ortholog of C. elegans sym-3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA15553.1	CJA15553.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA15553	CJA15553		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1084281
• Remark: Cjp-sym-3, CCATCAAACGCACCGGCGATTCAGTCAGGATCGTACTACGCAGAGAATTTCACATTCTAG, WBGene00134757
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term