WormMine: Gene WBGene00134179

• WormBase Gene ID: WBGene00134179
• Gene Name: CJA14975
• Sequence Name: CJA14975
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, RING/FYVE/PHD-type; Zinc finger, C3HC4 type (RING finger); and Zinc finger, RING-type. Is an ortholog of C. elegans C11H1.3. In C. elegans, C11H1.3 is involved in negative regulation of vulval development and protein localization to basolateral plasma membrane.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14975.1	CJA14975.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14975	CJA14975		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1083494
• Remark: CJA14975, AAACTACGAAGACGATAGTGGCCTAGAATGTATAATTTGTTTGTCTGACATTCGCGACAC, WBGene00134179
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term