WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00134190 Gene Name  Cjp-gly-9
Sequence Name  ? CJA14986 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Nucleotide-diphospho-sugar transferases; Glycosyltransferase 2-like; Glycosyl transferase family 2; Ricin B-like lectins; Ricin-type beta-trefoil lectin domain; and Ricin B, lectin domain. Is an ortholog of C. elegans gly-9. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA14986.1 CJA14986.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA14986 CJA14986   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA23967, CAAATCGCGAATATTTCTTTGAAATTGGCGGATACGACGAGGAAATGGATATCTGGGGCG, WBGene00179539   Expr1077690 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-gly-9, GGCGAATTTGAAGGCTGGAGACGATATTATTGTGGTGGAGTGTGATAGCAATGATAAGCA, WBGene00134190   Expr1091017 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term