WormMine: Gene WBGene00134022

• WormBase Gene ID: WBGene00134022
• Gene Name: CJA14818
• Sequence Name: CJA14818
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Ribosome biogenesis protein Nop53/GLTSCR2 and Nop53 (60S ribosomal biogenesis). Is an ortholog of C. elegans Y39B6A.33. In C. elegans, Y39B6A.33 is involved in positive regulation of cellular respiration.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14818.1	CJA14818.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14818	CJA14818		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1077928
• Remark: CJA14818, TGAAGAGTTTGCAGCGAAGAAACATGCTGCCGATTGGTGGCGAGAAGGAGAAGAAGCTGA, WBGene00134022
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term