WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00077259 Gene Name  Cre-hda-4
Sequence Name  ? CRE16602 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Histone deacetylase family; Histone deacetylase domain; Ureohydrolase domain superfamily; and Histone deacetylase domain superfamily. Is an ortholog of C. elegans hda-4. In C. elegans, hda-4 is involved in negative regulation of transcription by RNA polymerase II; receptor guanylyl cyclase signaling pathway; and regulation of neuron differentiation. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE16602.1 CRE16602.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE16602 CRE16602   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-hda-4, CTGAGCTCTGCTGCTCTGGAAACCCTTCCAAACCAGAGTGCATTGGAAACATTGCAGAAA, WBGene00077259   Expr1107376 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term