WormMine: Gene WBGene00137490

• WormBase Gene ID: WBGene00137490
• Gene Name: CJA18286
• Sequence Name: CJA18286
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: ShK domain-like and ShKT domain. Is an ortholog of C. elegans F07C4.10; F07C4.11; and T05B4.13.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA18286.1	CJA18286.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA18286	CJA18286		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081655
• Remark: CJA18286, GTTTCTCAAAAGATGGCACCGAACTCGATCAGGATATGCAAAAAACGGCGGCGGCGACGT, WBGene00137490
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term