WormMine: Gene WBGene00137909

• WormBase Gene ID: WBGene00137909
• Gene Name: Cjp-rbg-1
• Sequence Name: CJA18705
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Rab3 GTPase-activating protein catalytic subunit and Rab3GAP catalytic subunit, conserved domain. Is an ortholog of C. elegans rbg-1. In C. elegans, rbg-1 is involved in amyloid fibril formation; autophagy; and positive regulation of autophagosome assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA18705.1	CJA18705.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA18705	CJA18705		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070844
• Remark: Cjp-rbg-1, ACAAAACTGTTGCGAATATTTGGGAGAATTCCGGGTTGACTGAAACGGATTATATCGTCA, WBGene00137909
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term