WormMine: Gene WBGene00137910

• WormBase Gene ID: WBGene00137910
• Gene Name: Cjp-abi-1
• Sequence Name: CJA18706
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: ABI family; SH3 domain; SH3-like domain superfamily; and Variant SH3 domain. Is an ortholog of C. elegans abi-1. In C. elegans, abi-1 is involved in several processes, including positive regulation of endocytosis; presynaptic actin cytoskeleton organization; and synaptic vesicle clustering.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA18706.1	CJA18706.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA18706	CJA18706		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1090016
• Remark: Cjp-abi-1, AAAAGAGGATGAGTTGACACTTCGCGAGAACGCTATTGTGTACGTGGTGAAGAAGAATGA, WBGene00137910
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term