WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00137082 Gene Name  Cjp-swsn-9
Sequence Name  ? CJA17880 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Bromodomain; Domain of unknown function (DUF3512); Protein of unknown function DUF3512; and Bromodomain-like superfamily. Is an ortholog of C. elegans swsn-9. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA17880.1 CJA17880.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA17880 CJA17880   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA22715, GGCGGAGAACATCCAACAACATCTTGCCCATCAAATCACCCAACACACTGCTCCAGAAGC, WBGene00178287   Expr1086386 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-tag-298, GACGGGATTCCTGAATGACATACGCCAACAAGTGCTTGTTCCTAAAGTGGTTTGTTCAAA, WBGene00137082   Expr1090692 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term