WormMine: Gene WBGene00136400

• WormBase Gene ID: WBGene00136400
• Gene Name: Cjp-lgg-1
• Sequence Name: CJA17197
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Ubiquitin-like domain superfamily; Autophagy protein Atg8 ubiquitin-like; and Autophagy protein Atg8 ubiquitin like. Is an ortholog of C. elegans lgg-1. In C. elegans, lgg-1 is involved in several processes, including dauer larval development; positive regulation of autophagosome assembly; and response to stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA17197.1	CJA17197.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA17197	CJA17197		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1071820
• Remark: Cjp-lgg-1, AAAACGCATTCAGCTCCGTCCAGAAGATGCCTTGTTTTTCTTTGTCAACAATGTCATTCC, WBGene00136400
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term