WormMine: Gene WBGene00136292

• WormBase Gene ID: WBGene00136292
• Gene Name: CJA17089
• Sequence Name: CJA17089
• Organism: Caenorhabditis japonica
• Automated Description: Is an ortholog of C. elegans unc-108. In C. elegans, unc-108 is involved in several processes, including dense core granule maturation; phagosome maturation involved in apoptotic cell clearance; and regulation of locomotion involved in locomotory behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA17089.1	CJA17089.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA17089	CJA17089		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1075028
• Remark: Cjp-unc-108, ATTCAGGAGGGTGTGTTCGATATTAACAACGAGGCGAATGGCATCAAACTGGGACCACAA, WBGene00136292
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term