WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00025890 Gene Name  Cbr-samp-1
Sequence Name  ? CBG02931 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Ima1, N-terminal domain; Ima1 N-terminal domain; and Transmembrane protein 201. Is an ortholog of C. elegans samp-1. In C. elegans, samp-1 is involved in embryo development and nuclear migration along microtubule. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG02931b.1 CBG02931b.1   [unknown]
Transcript:CBG02931a.1 CBG02931a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG02931a CBG02931a   [unknown]
CDS:CBG02931b CBG02931b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG02931, TGGATCAACACTGCGAGAAGTGGTAGGGAATCGAAATAAATCACGTCGCTGGTTTTTTGC, WBGene00025890   Expr1069811 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term