WormMine: Gene WBGene00072121

• WormBase Gene ID: WBGene00072121
• Gene Name: CRE12328
• Sequence Name: CRE12328
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: BTB And C-terminal Kelch; SKP1/BTB/POZ domain superfamily; BTB/Kelch-associated; and BTB/POZ domain. Is an ortholog of C. elegans eor-1. In C. elegans, eor-1 is involved in several processes, including determination of adult lifespan; nematode male tail tip morphogenesis; and signal transduction.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE12328.1	CRE12328.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE12328	CRE12328		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1113343
• Remark: CRE12328, AGGGAATGAAGAAACGATTGCAACCGATTCAAACGCCTACCGCCGCAGCTACAGAGAATG, WBGene00072121
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term