WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00071335 Gene Name  Cre-mks-6
Sequence Name  ? CRE26811 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: C2 domain; CC2D2A N-terminal C2 domain; C2 domain superfamily; and CC2D2A, N-terminal, C2 domain. Is an ortholog of C. elegans mks-6. In C. elegans, mks-6 is involved in non-motile cilium assembly and protein localization to ciliary transition zone. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE26811.1 CRE26811.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE26811 CRE26811   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE26811, GACTTCTTTGCTCATGTTATACAGATTGATGTGGCGTTGGCGGTGCTTAAGCCGAAGAAG, WBGene00071335   Expr1103675 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term