WormMine: Gene WBGene00070721

• WormBase Gene ID: WBGene00070721
• Gene Name: Cre-csn-4.2
• Sequence Name: CRE10647
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Winged helix DNA-binding domain superfamily; PCI domain; 26S Proteasome non-ATPase regulatory subunit 12/COP9 signalosome complex subunit 4; Proteasome component (PCI) domain; Winged helix-like DNA-binding domain superfamily; and COP9 signalosome complex subunit 4. Is an ortholog of C. elegans csn-4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE10647.1	CRE10647.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE10647	CRE10647		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1097508
• Remark: CRE10647, CTTGGAACACTGGAACAAGTGAACAAAGTCAGCGATATGATTGTCGCCCAACATCCCCAA, WBGene00070721
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term