WormMine: Gene WBGene00070407

• WormBase Gene ID: WBGene00070407
• Gene Name: CRE18221
• Sequence Name: CRE18221
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Ribonuclease Z/Hydroxyacylglutathione hydrolase-like; Metallo-beta-lactamase; Metallo-beta-lactamase superfamily; and Metallo-beta-lactamase domain-containing protein 1. Is an ortholog of C. elegans C25D7.5. In C. elegans, C25D7.5 is involved in innate immune response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE18221.1	CRE18221.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE18221	CRE18221		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1092333
• Remark: CRE18221, TCATTGATTCAGTCAACTCCAGGACCAACACCGAATTCGATAACTGTAATCGTGCGAAAC, WBGene00070407
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term