WormMine: Gene WBGene00074496

• WormBase Gene ID: WBGene00074496
• Gene Name: Cre-scl-1.1
• Sequence Name: CRE10312
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Venom allergen 5-like; Cysteine-rich secretory protein family; Cysteine-rich secretory protein-related; CAP superfamily; and CAP domain. Is an ortholog of C. elegans scl-1. In C. elegans, scl-1 is involved in determination of adult lifespan; response to UV; and response to heat.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE10312.1	CRE10312.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE10312	CRE10312		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1118032
• Remark: CRE10312, TGAAACGATTTACCAGCAAGGATCGACATGTTCCAAGTGTCCAGATTCAGCGAAATGCGA, WBGene00074496
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term