WormMine: Gene WBGene00026188

• WormBase Gene ID: WBGene00026188
• Gene Name: Cbr-cec-3
• Sequence Name: CBG03306
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Chromo-like domain superfamily; Chromo domain; Chromo (CHRromatin Organisation MOdifier) domain; and Chromo/chromo shadow domain. Is an ortholog of C. elegans cec-3. In C. elegans, cec-3 is involved in negative regulation of gene expression.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03306b.1	CBG03306b.1		[unknown]
Transcript:CBG03306a.1	CBG03306a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03306a	CBG03306a		[unknown]
CDS:CBG03306b	CBG03306b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050005
• Remark: CBG03306, GATTTACATCGTCGGAAGCTTGTTCTTCTGACAAACTCTACTACTGGCGAGCGAAAAGTC, WBGene00026188
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term