WormMine: Gene WBGene00074916

• WormBase Gene ID: WBGene00074916
• Gene Name: CRE18368
• Sequence Name: CRE18368
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: RIPOR family member 3; FAM65, N-terminal; and Filopodia upregulated, FAM65. Is an ortholog of C. elegans Y37A1A.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE18368.1	CRE18368.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE18368	CRE18368		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1104179
• Remark: CRE18368, ATTCCTACACTGCCACGAAGGAAAATCATTGAACAGGGAAACAGTCGATGGCACGATTGA, WBGene00074916
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term