WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00182499 Gene Name  CJA26927
Sequence Name  ? CJA26927 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Beta-hexosaminidase-like, domain 2; Ankyrin repeat; Domain of unknown function DUF3447; Ankyrin repeat-containing domain superfamily; and Ankyrin repeats (3 copies). Is an ortholog of C. elegans T16G1.9. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA26927c.1 CJA26927c.1   [unknown]
Transcript:CJA26927a.1 CJA26927a.1   [unknown]
Transcript:CJA26927b.1 CJA26927b.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA26927b CJA26927b   [unknown]
CDS:CJA26927c CJA26927c   [unknown]
CDS:CJA26927a CJA26927a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA26927, ACACGGCGATCGTGAAAGGAGACGCAGATATTGTCAAATTGTTGCTTGCCAATGGAGCAA, WBGene00182499   Expr1085017 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term