WormMine: Gene WBGene00073753

• WormBase Gene ID: WBGene00073753
• Gene Name: CRE18317
• Sequence Name: CRE18317
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Alpha crystallin/Small heat shock protein, animal type; Alpha crystallin/Hsp20 domain; Hsp20/alpha crystallin family; and HSP20-like chaperone. Is an ortholog of C. elegans F08H9.4. In C. elegans, F08H9.4 is involved in response to topologically incorrect protein.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE18317.1	CRE18317.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE18317	CRE18317		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1112365
• Remark: CRE18317, GATCTCAAACACCGATGAGAAGTTCGCAGTCAACCTCAATGTCTCTCAATTCAAGCCTGA, WBGene00073753
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term