1 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00007036 | sod-5 | ZK430.3 | Caenorhabditis elegans |
WormBase ID | WBStrain00054749 | CGC Received | 2023-01-10 |
Genotype | sod-5(utx61[mScarlet-I-C1::3xMyc::sod-5]) II. | Laboratory | CGC |
Mutagen | CRISPR_Cas9 | Name | GLW79 |
Outcrossed | x0 | Remark | N-terminal tag of SOD-5 via CRISPR/Cas9 knock-in of mScarlet at sod-5 locus. Insertion verified by PCR and fluorescence. Left flank: 5' tgtgctaacgaaaattttactaaaaggaaa 3'; Right flank: 5' ATGGATATTCTCTCTGATATTGCAAATGCC 3 (1 silent mutation); sgRNA: tacCTGTGGAAGAACGGCAT; Cas9/sgRNA plasmid: pGLOW122; mScarlet^SEC^3xMyc plasmid: pGLOW129; SEC insertion allele strain: GLW78. |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00007036 | sod-5 | ZK430.3 | Caenorhabditis elegans |