WormMine: Gene WBGene00073137

• WormBase Gene ID: WBGene00073137
• Gene Name: Cre-ehbp-1
• Sequence Name: CRE29238
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: EH domain-binding protein 1; Calponin homology (CH) domain; NT-type C2 domain; Calponin homology domain; bMERB domain; N-terminal C2 in EEIG1 and EHBP1 proteins; Bivalent Mical/EHBP Rab binding domain; and CH domain superfamily. Is an ortholog of C. elegans ehbp-1. In C. elegans, ehbp-1 is involved in endocytic recycling; protein secretion; and receptor recycling.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE29238.1	CRE29238.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE29238	CRE29238		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1107241
• Remark: Cre-ehbp-1, GCAGATCGACGAGGTCACACAGATTGCCGATGATATTCCGAGGACGAATGAGACGAAGAC, WBGene00073137
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term