WormMine: Gene WBGene00038166

• WormBase Gene ID: WBGene00038166
• Gene Name: CBG18827
• Sequence Name: CBG18827
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: NADH dehydrogenase [ubiquinone] (complex I), alpha subcomplex, subunit 2; Ribosomal protein/NADH dehydrogenase domain; Thioredoxin-like superfamily; and Mitochondrial ribosomal protein L51 / S25 / CI-B8 domain. Is an ortholog of C. elegans Y63D3A.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18827.1	CBG18827.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18827	CBG18827		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050168
• Remark: CBG18827, GCGAGATATGAGCATGGAGTGGAGAGAGTCGCCACTCTGGAAGACTTGTCGAGAGAAAAT, WBGene00038166
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term