WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00033969 Gene Name  Cbr-spat-2
Sequence Name  ? CBG13163 Organism  Caenorhabditis briggsae
Automated Description  Is an ortholog of C. elegans spat-2. Biotype  SO:0001217
Genetic Position 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG13163a.1 CBG13163a.1   [unknown]
Transcript:CBG13163b.1 CBG13163b.1   [unknown]
Transcript:CBG13163c.1 CBG13163c.1   [unknown]
Transcript:CBG13163d.1 CBG13163d.1   [unknown]
 

Other

4 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG13163c CBG13163c   [unknown]
CDS:CBG13163b CBG13163b   [unknown]
CDS:CBG13163a CBG13163a   [unknown]
CDS:CBG13163d CBG13163d   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG13163, AGTCGCCAGTCACCATAATGTTGCAAACAACTGCTCCATCTTTCCACAACACTACATCAG, WBGene00033969   Expr1069722 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cbr-spat-2, CTGCTCATCCCACGACACTTGGAGACTTTATGGAGAGTACTAAGAAGGACACTCATAAAA, WBGene00033970   Expr1057959 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term