3 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00003514 | myo-2 | T18D3.4 | Caenorhabditis elegans |
WBGene00004496 | rps-27 | F56E10.4 | Caenorhabditis elegans |
WBGene00006789 | unc-54 | F11C3.3 | Caenorhabditis elegans |
WormBase ID | WBStrain00055514 | CGC Received | 2023-09-14 |
Genotype | F14H3.12(ve873[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Laboratory | CGC |
Mutagen | CRISPR_Cas9 | Name | RG3373 |
Remark | Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence:ATGAACTCCATTCAAATACAAGCGTGGTAG ; Right flanking sequence:CCTGATCAGCAGTCTCCAGCGCAAACCCAA. F14H3.12 sgRNA #1:TGTGCAGACCTGAAAGAACT ; F14H3.12 sgRNA #2:AAGATCAGGCGCGAGCAGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00003514 | myo-2 | T18D3.4 | Caenorhabditis elegans |
WBGene00004496 | rps-27 | F56E10.4 | Caenorhabditis elegans |
WBGene00006789 | unc-54 | F11C3.3 | Caenorhabditis elegans |